Amino acids
DNA sequencing.
3-letter sequences encode amino acids in DNA. For example, TTT is phenylalanine and TTA is leucine. This program reads a DNA sequence stored in a file and outputs the number of a particular amino acid in the sequence requested by the user. E.g. in the sequence: ACGTTTGTATTT the sequence TTT appears twice.
Make
Write a program that asks the user to enter three characters and outputs how many times that sequence of characters appears in a file.
Use this boilerplate code as a starting point:
Success Criteria
Remember to add a comment before a subprogram, selection or iteration statement to explain its purpose.
Complete the subprogram called `get_amino_acid` that:
- Asks the user to input an amino acid.
- Validates the input to ensure only three letters of ACG or T are accepted.
- Returns the valid choice.
Complete the subprogram called `check_sequence` that:
- Takes the amino acid as a parameter.
- Opens the file called, `dna.txt` for reading. Note this is included in the Trinket above for you to use as source data.
- If the file cannot be found it returns -1.
- Reads the file a line at a time.
- Counts the number of amino acids found in the file.
- Closes the file.
- Returns the number of amino acids of the given sequence found.
Complete the `main program` so that:
- Calls `get_amino_acid` to input a valid amino acid.
- Calls `check_sequence` to return the number of the amino acids in the file.
- If the number is -1, the message, "DNA file not found." is output.
- If the number is >-1 the number of amino acids is output using the format shown below.
Typical inputs and outputs from the program would be:
`dna.txt` file:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCGG
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAG
Enter the amino acid to find: CCC
There are 4 CCC amino acids in the DNA sequence.
Enter the amino acid to find: GGT
There are 0 GGT amino acids in the DNA sequence.
Enter the amino acid to find: GGG
There are 3 GGG amino acids in the DNA sequence.
Knowledge Organiser
Use these resources as a reference to help you meet the success criteria.
Programming guide:
Evaluate
Run the unit tests below to check that your program has met the success criteria.
Enter the amino acid to find: AAC
There are 0 AAC amino acids in the DNA sequence.
Enter the amino acid to find: AGF
Enter the amino acid to find: TAA
There are 0 TAA amino acids in the DNA sequence.
Enter the amino acid to find: CAC
There are 1 CAC amino acids in the DNA sequence.
Enter the amino acid to find: CCC
There are 4 CCC amino acids in the DNA sequence.
Enter the amino acid to find: GAG
There are 2 GAG amino acids in the DNA sequence.
Enter the amino acid to find: GCC
There are 3 GCC amino acids in the DNA sequence.
Check that you have:
- Used comments within the code to describe the purpose of subprograms, conditions and iterations.
- Used meaningful identifier names. That means the names of subprograms and variables indicate what they are for.
